SET #1 DIALIGN helped identify at least one region of > 6bp that is perfectly conserved across 3 or more genes and well conserved across 2 others. I highlighted this area by placing brackets [] around it, with the motif being "ATTTAA". There were 2 other regions with strong conservation across at least 3 genes, which I highlighted with parens (). Pyrococcus Abyssi PAB1159 1 ---------- Pyrococcus Horikoshii PH1987 1 (ATTAGCAACT) Methanobacterium Ther. MTH1425 1 ---------- Methanococcus Jannaschii MJ1130 1 ---------- Thermoplasma Volcanium TVN1276 1 (AATATCAATA) Thermoplasma Acidophilum TA0324 1 (AATATCAATG) ********** ********** ********** ********** ********** ********** ********** ********** Pyrococcus Abyssi PAB1159 17 (AA ATCGTTGA) Pyrococcus Horikoshii PH1987 64 (AA AACGTTAG) Methanobacterium Ther. MTH1425 19 (AT AACCGGAG) Methanococcus Jannaschii MJ1130 3 (AA AACTTTTT) Thermoplasma Volcanium TVN1276 64 (AA AATTTACC) Thermoplasma Acidophilum TA0324 82 TCGTTcc || |||||||| ** ******** ** ******** ** ******** ** ******** ** ******** ** ******** ** ******** ** ******** ** ******** ** ******** Pyrococcus Abyssi PAB1159 47 [AATTTAAT] Pyrococcus Horikoshii PH1987 93 [AATTTAAC] Methanobacterium Ther. MTH1425 48 AGTTACAC Methanococcus Jannaschii MJ1130 42 [ATTTAAAT] Thermoplasma Volcanium TVN1276 99 [ATTTAAAT] Thermoplasma Acidophilum TA0324 113 [ATTTAAAT] ******** ******** ******** ******** ******** ******** ******** ******** ******** ******* CLUSTALW didn't align things nearly as well. Out of its alignment I only really see 1 region where there appears to be good conservation across at least 3 genes. I marked the area with brackets []. CLUSTAL W (1.81) multiple sequence alignment Pyrococcus Horikoshii PH1987 [TT----AATTTA] Methanococcus Jannaschii MJ1130 [AT----AATTGA] Pyrococcus Abyssi PAB1159 [TTT---AATTTA] Methanobacterium Ther. MTH1425 [TT----AGTTAC] Thermoplasma Acidophilum TA0324 TTCCTGCGCTGA Thermoplasma Volcanium TVN1276 TATGGATAATTA * ==================================================================================================== SET #2 For this set here are the organisms & gene IDs: Pyrococcus Abyssi PAB0931 Pyrococcus Horikoshii PH0636 Haemophilus influenzae HI0078 Pasteurella multocida PM0945 Thermoplasma Volcanium TVN1244 Thermoplasma Acidophilum TA1147 On this set DIALIGN found a couple regions where things were well conserved across 4 or 5 genes and perfectly conserved across 2. I've marked these regions in parens (). Pyrococcus Abyssi PAB0931 1 (ATCACCAAAAA-ATTTTACC) Pyrococcus Horikoshii PH0636 1 (ATCACCAAAAAgAATTTACC) Haemophilus influenzae HI0078 1 (TCCCTCTAAAA-AATTAAgg) Pasteurella multocida PM0945 1 (TTCCTCTAATA-GTTTTATA) Thermoplasma Volcanium TVN1244 1 (TTAAACTAAAT-TAATAATA) Thermoplasma Acidophilum TA1147 1 (ATCAGCAAAGC-AATCCGTC) *********** ******** *********** ******** *********** ******** *********** ******** *********** ******** *********** ******** ********* ****** ******** Pyrococcus Abyssi PAB0931 38 (TTTAAA---- ---CGTTGC-) Pyrococcus Horikoshii PH0636 38 (TTTAAA---- ---GCTTGC-) Haemophilus influenzae HI0078 37 (TTCCACAATC GAGGTAAAA-) Pasteurella multocida PM0945 39 (TTTCATAAAA GCGCATTAA-) Thermoplasma Volcanium TVN1244 61 (TATCACATAT TCGCATTAT-) Thermoplasma Acidophilum TA1147 100 (TCAAACGGTA TCGGATTATc) |||||| ********** ********* ********** ********* ********** ********* ********** ********* ********** ********* ****** ****** ****** ****** ****** ****** ****** ****** ***** The CLUSTALW alignment found several places where 2 or 3 genes were reasonably conserved. It even found a couple regions where things seemed well conserved over 4 or 5 genes, which I marked with parens (). CLUSTAL W (1.81) multiple sequence alignment Pyrococcus Abyssi PAB0931 (TGCCAAAAC)-CGA(CAGTCTAAT)-------AAGAGAA-TACCCCGAT(TTTAGC) Pyrococcus Horikoshii PH0636 (TGCCAAAAC)-CGA(CATCCTAAT)-------AAAATTCCTGGATGGAG(ATTAAG) Thermoplasma Acidophilum TA1147 TATCGGATT -ATC(CATGCCAAT)GG-----AGGATCAATGCATATAT(ATTAAC) Haemophilus influenzae HI0078 (AGGTAAAAG)-TGC(TATAAAAGT)GC-----GGTTTGTTTTTATTTCA(TTTTAC) Pasteurella multocida PM0945 (TGGCAAATT)ACGC(TATGCTAAA)TT-----TATAACACTCCTATACA(CTTAAG) Thermoplasma Volcanium TVN1244 TATAGGAGA TTTA(GAAACCAAA)TCTCCGAAACCGTAGCAGATGGTA(ATTGAT) * * * **